![Abstract metal vintage molecules medical background](https://23899467.fs1.hubspotusercontent-na1.net/hub/23899467/hubfs/Abstract%20metal%20vintage%20molecules%20medical%20background.jpeg?width=300&name=Abstract%20metal%20vintage%20molecules%20medical%20background.jpeg)
GETTING STARTED
E-Sign (or Print/Scan) Quote & Provide PO#
LIBRARY PREPARATION
Across a wide range of sample types and analysis
In general, 2 aliquots in separate PCR plates: one for QC and one for library preparation. See more details
Note: all samples are required to meet strict quantity and quality thresholds. Samples outside of these thresholds may be able to be submitted/processed if agreed to prior by the centre.
Samples can be dropped off in person at SAHMRI or the Flinders Node, or sent by express post to SAHMRI. All samples need to be accompanied by a completed Sample Submission Form (sent via email AND in hardcopy) and labelled clearly with sample name (<10 characters), date and client name.
DROP-OFF LOCATIONS:
SHIPPING SAMPLES:
Address: SAHMRI Building, Level 5, Room 303, North Terrace, South Australia, 5000, Australia
Phone: +61 8 8128 4152
- DNA or RNA quantification
- RNA fragment analysis
- Genomic DNA fragment analysis
- Library Quantification
NEED SAMPLE EXTRACTION?
We can help with that!
tar -xvf [FileName].tar.gz
Sample Requirements by Service
- Whole-Genome (WGS)
- Whole-Exome (WES)
- DNA Methylation, or Whole-Genome Bisulfite (WGBS)
- Single Cell RNA (scRNA-seq)
- Spatial Transcriptomics
- Chromatin Immunoprecipitation Sequencing (ChIP-Seq)
- Small RNA (Small RNA-seq)
- mRNA
- Total RNA
- Assay of Transposase Accessible Chromatin (ATAC-Seq)
- Metagenomics
- Microbial Profiling (Microbiome)
Whole-Genome (WGS)
Submit 2 x gDNA aliquots in 2 separate 96-well plates (for library prep & QC), down the plate rather than across the rows. Leave Position H12 blank for SAGC internal control.
For QC: 10 ng/µl in 5µl
For Library Prep: 5-15 ng/µl in 30µlWhole-Exome (WES)
Submit 2 x gDNA aliquots in 2 separate 96-well plates (for library prep & QC), down the plate rather than across the rows. Leave Position H12 blank for SAGC internal control.
For QC: 25 ng/µl in 5µl
For Library Prep: 25 ng/µl in 10µl
DNA Methylation, or Whole-Genome Bisulfite (WGBS)
Submit 2 x gDNA samples in 2 separate 96-well plates (for library prep & QC), down the plate rather than across the rows. Leave Position H12 blank for SAGC internal control.
For QC: 1-10ng/µl in 5µl*
For Library Prep: 0.1-10ng/µl in 25µl*
Single Cell RNA (scRNA-seq)
Submit Fresh Cells in sterile microcentrifuge tubes. Cell Submission ~ 700 – 1200 cells/µl
Spatial Transcriptomics
For Visium 10X: submit Fresh/FFPE Tissue OR Pre-Stained/Imaged Tissues adhered to the Visium Slides. More information here from 10X Genomics
For Xenium 10X: submit Fresh/FFPE Tissue OR Tissues adhered to the Xenium Slides. More information here from 10X Genomics
Fresh-Frozen or FFPE Tissues
Stereo-seq (STOmics):submit Fresh OR tissue adhere to Stereo-seq chip slides.
More information here from BGI
Fresh-Frozen or PFA Tissues
Chromatin Immunoprecipitation Sequencing (ChIP-Seq)
Submit 2 x Chromatin Immunoprecipitated & Fragmented gDNA samples in 2 separate 96-well plates (for library prep & QC), down the plate rather than across the rows. Leave Position H12 blank for SAGC internal control.
For QC: 1-10ng/µl in 5µl
For Library Prep: 1-10ng/µl in 15µl
Small RNA (Small RNA-seq)
Submit 2 x Total RNA or enriched Small RNA aliquots in 2 separate 96-well plates (for library prep & QC), down the plate rather than across the rows. Leave Position H12 blank for SAGC internal control.
For QC: 2-165 ng/µl in 5µl*
For Library Prep: 2-165 ng/µl in 10µl*
*Input requirements vary greatly depending on which small RNA library preparation kit is used.
Please contact us to discuss which is the best option for your project
mRNA
Submit 2 x TotalRNA aliquots in 2 separate 96-well plates (for library prep & QC), down the plate rather than across the rows. Leave Position H12 blank for SAGC internal control.
For QC: 100 ng/µl in 5µl*
For Library Prep: 10-20 ng/µl in 50µl*
Total RNA
Submit 2 x Total RNA aliquots in 2 separate 96-well plates (for library prep & QC), down the plate rather than across the rows. Leave Position H12 blank for SAGC internal control.
For QC: 100 ng/µl in 5µl*
For Library Prep: 20-50 ng/µl in 10µl*
Assay of Transposase Accessible Chromatin (ATAC-Seq)
Submit 2 x Digested gDNA samples in 2 separate 96-well plates down the plate rather than across the rows. Leave Position H12 blank for SAGC internal control.
For QC: 1-10 ng/µl in 5µl
For Library Prep: 1-10 ng/µl in 15µl
Metagenomics
Submit 2 x gDNA aliquots in 2 separate 96-well plates (for library prep and QC) down the plate rather than across the rows. Leave Position H12 blank for SAGC internal control.
For QC: 10-100 ng/µl in 5µl
For Library Prep: 5-15 ng/µl in 30µl
Microbial Profiling (Microbiome)
Submit 2 x gDNA aliquots in 2 separate 96-well plates (For Library Prep and QC), down the plate rather than across the rows. Leave Position H12 blank for SAGC internal control.
For QC: 10 ng/µl in 5µl
For Library Prep: 10 ng/µl in 15µl
Current Validated Primers:
16S V1-V3
27F: AGRGTTTGATCMTGGCTCAG
519R: GTNTTACNGCGGCKGCTG
16S V3-V4
314F: CCTACGGGNGGCWGCAG
806R: GACTACHVGGGTATCTAATCC
16S V4
515F: GTGCCAGCMGCCGCGGTAA
806R: GGACTACHVGGGTWTCTAAT
ITS
ITS1: CTTGGTCATTTAGAGGAAGTAA
ITS2: GCTGCGTTCTTCATCGATGC