GETTING STARTED
E-Sign (or Print/Scan) Quote & Provide PO#
LIBRARY PREPARATION
Across a wide range of sample types and analysis
In general, 2 aliquots in separate PCR plates: one for QC and one for library preparation. See more details
Note: all samples are required to meet strict quantity and quality thresholds. Samples outside of these thresholds may be able to be submitted/processed if agreed to prior by the centre.
Samples or Libraries can be dropped off in person at SAHMRI or the Flinders Node, or sent by express post to either site. All samples or libraries need to be accompanied by either a completed Sample or Library Submission Form (sent via email AND in hardcopy). Tubes/plates should be labelled clearly with sample name (<10 characters and must only contain alphanumeric characters (a-z, A-Z, 0-9) and underscores (_), no spaces or other symbols), date and client name.
We recommend submitted samples in semi-skirted PCR plates with a plate seal that can be stored at -80°C (i.e. Bio-Rad Microseal “b” PCR Plate Sealing Film or equivalent).
DROP-OFF LOCATIONS:
- SAHMRI – North Terrace, Adelaide CBD
- Health and Medical Research Building (HMRB), Flinders University, Bedford Park
NOTE: To drop off submissions at HMRB, please book a time using this link and meet in front of the building or in the foyer. (or contact Flinders Node Manager)
SHIPPING SAMPLES:
Address: SAHMRI Building, Level 5, Room 303, North Terrace, South Australia, 5000, Australia
Phone: +61 8 8128 4152
SAHMRI
Address: SAHMRI Building, Level 5, Room 303, North Terrace, South Australia, 5000, Australia
Attn: SAGC
Phone: +61 8 8128 4152
Flinders:
Health and Medical Research Building (HMRB), Flinders University, Bedford Park, 5042, SA
Attn: SAGC
Ph: +61 8 8432 4791
- DNA or RNA quantification (Qubit)
- gDNA, RNA and Library fragment analysis (TapeStation)
NEED SAMPLE EXTRACTION?
We can help with that too!
tar -xvf [FileName].tar.gz
Sample Requirements by Service
- Whole-Genome (WGS)
- Whole-Exome (WES)
- Enzymatic Methyl-Seq
- Single Cell RNA (scRNA-seq)
- Spatial Transcriptomics
- Chromatin Immunoprecipitation Sequencing (ChIP-Seq)
- Small RNA (Small RNA-seq)
- mRNA
- Total RNA
- Assay of Transposase Accessible Chromatin (ATAC-Seq)
- Metagenomics
- Microbial Profiling (Microbiome)
Whole-Genome (WGS)
Submit 2 x gDNA aliquots in 2 separate 96-well semi-skirted PCR plates (for library prep & QC), down the plate rather than across the rows. Leave Position H12 blank for SAGC internal control.
For QC: 20 ng/µl in 10µl
For Library Prep: 20 ng/µl in 50µlWhole-Exome (WES)
Submit 2 x gDNA aliquots in 2 separate 96-well semi-skirted PCR plates (for library prep & QC), down the plate rather than across the rows. Leave Position H12 blank for SAGC internal control.
For QC: 20 ng/µl in 10 µl
For Library Prep: 20 ng/µl in 50 µl
Enzymatic Methyl-Seq
Submit 2 x gDNA samples in 2 separate 96-well plates (for library prep & QC), down the plate rather than across the rows. Leave Position H12 blank for SAGC internal control.
For QC: 10 ng/µl in 10 µl
For Library Prep: 10 ng/µl in 50µl*
Single Cell RNA (scRNA-seq)
Submit Fresh Cells in sterile microcentrifuge tubes. Cell Submission ~ 1000 – 2000 cells/µl in PBS + 0.04% BSA. Please contact us for more information.
Client prepared libraries should be pooled and submitted in a single tube. A minimum of 10 nM in 100 µl of pooled library should be provided.
Spatial Transcriptomics
Fresh-Frozen or FFPE Tissues blocks. Please contact us for more information.
Submit Fresh/FFPE Tissue OR Pre-Stained/Imaged Tissues adhered to application specific slides. Please contact us for more information.
Client prepared libraries should be pooled and submitted in a single tube. Please contact us for more information on pooled library requirements.
We recommend following the specific manufacturer's recommendations.
Chromatin Immunoprecipitation Sequencing (ChIP-Seq)
Submit 2 x Chromatin Immunoprecipitated & Fragmented gDNA samples in 2 separate 96-well semi-skirted PCR plates (for library prep & QC), down the plate rather than across the rows. Leave Position H12 blank for SAGC internal control.
For QC: 1-10 ng/µl in 10 µl
For Library Prep: 10 ng/µl in 30 µl
Small RNA (Small RNA-seq)
Submit 2 x TotalRNA or enriched SmallRNA aliquots in 2 separate 96-well semi-skirted PCR plates (for library prep & QC), down the plate rather than across the rows. Leave Position H12 blank for SAGC internal control.
For QC: 25 ng/µl in 10 µl*
For Library Prep: 25 ng/µl in 30 µl*
mRNA
Submit 2 x RNA aliquots in 2 separate 96-well semi-skirted PCR plated (for library prep & QC), down the plate rather than across the rows. Leave Position H12 blank for SAGC internal control.
For QC: 30 ng/µl in 10 µl*
For Library Prep: 10 ng/µl in 100 µl
Total RNA
Submit 2 x Total RNA aliquots in 2 separate 96-well semi-skirted PCR plates (for library prep & QC), down the plate rather than across the rows. Leave Position H12 blank for SAGC internal control.
For QC: 50 ng/µl in 10µl
For Library Prep: 50 ng/µl in 50µl*
Assay of Transposase Accessible Chromatin (ATAC-Seq)
Submit 2 x Digested gDNA samples in 2 separate 96-well semi-skirted PCR plates down the plate rather than across the rows. Leave Position H12 blank for SAGC internal control.
For QC: 10 ng/µl in 10 µl
For Library Prep: 5 ng/µl in 10 µl
Metagenomics
Submit 2 x gDNA aliquots in 2 separate 96-well plates (for library prep and QC) down the plate rather than across the rows. Leave Position H12 blank for SAGC internal control.
For QC: 10 ng/µl in 10 µl
For Library Prep: 20 ng/µl in 50 µl
Microbial Profiling (Microbiome)
Submit 2 x gDNA aliquots in 2 separate 96-well plates (For Library Prep and QC), down the plate rather than across the rows. Leave Position H12 blank for SAGC internal control.
For QC: 10 ng/µl in 10 µl
For Library Prep: 10 ng/µl in 20 µl
Current Validated Primers:
16S V1-V3
27F: AGRGTTTGATCMTGGCTCAG
519R: GTNTTACNGCGGCKGCTG
16S V3-V4
314F: CCTACGGGNGGCWGCAG
806R: GACTACHVGGGTATCTAATCC
16S V4
515F: GTGCCAGCMGCCGCGGTAA
806R: GGACTACHVGGGTWTCTAAT
ITS
ITS1: CTTGGTCATTTAGAGGAAGTAA
ITS2: GCTGCGTTCTTCATCGATGC